#!/usr/bin/perl -w
# Calculating the reverse complement of a strand of DNA

# The DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

print "Here is the starting DNA:\n\n$DNA\n\n";

# Calculate the reverse complement
# XXX  Warning: this attempt will fail!  XXX
#
# First, copy the DNA into new variable $revcom 
# (short for REVerse COMplement)
# Notice that variable names can use lowercase letters like
# "revcom" as well as uppercase like "DNA".  
# In fact, lowercase is more common.
#
# It doesn't matter if we first reverse the string and then
# do the complementation; or if we first do the complementation
# and then reverse the string.  Same result each time.
# So when we make the copy we'll do the reverse in the same statement.

$revcom = reverse $DNA;

# Next substitute all bases by their complements,
# A->T, T->A, G->C, C->G

$revcom =~ s/A/T/g;
$revcom =~ s/T/A/g;
$revcom =~ s/G/C/g;
$revcom =~ s/C/G/g;

# Print the reverse complement DNA onto the screen
print "Here is the reverse complement DNA:\n\n$revcom\n";

# Our reverse complement should have all the bases in it, since the
# original DNA had all the bases-but ours only has A and G!
#
# Do you see why?
#
# The problem is that the first two substitute commands above change
# all the A's to T's (so there are no A's) and then all the
# T's to A's (so all the original A's and T's are all now A's).
# Same thing happens to the G's and C's all turning into G's.

print "\nThat was a bad algorithm, and the reverse complement was wrong!\n";
print "Try again ... \n\n";

# Make a new copy of the DNA (see why we saved the original?)
$revcom = reverse $DNA;

# The Perl translate/transliterate command is just what we need:
$revcom =~ tr/ACGTacgt/TGCAtgca/;

print "Here is the reverse complement DNA:\n\n$revcom\n";

print "\nThis time it worked!\n\n";
exit;